Skip to content

Latest commit

 

History

History
298 lines (232 loc) · 12.2 KB

File metadata and controls

298 lines (232 loc) · 12.2 KB

Pairwise Alignment Benchmarks

This repository contains a few things:

pa-wrapper: Wrapper API

pa-wrapper contains a unified API to a number of aligners:

A*PA, A*PA2 Block Aligner, Edlib, Ksw2, Parasail, Triple Accel, [Bi]Wfa

Create an AlignerParams object and call build_aligner() on it to obtain an instance of an aligner, on which .align() can be called repeatedly.

Adding an aligner To add an aligner, update `pa-wrapper/Cargo.toml` and `pa-wrapper/src/lib.rs`, and add a new file `pa-wrapper/src/wrappers/.rs`. Remember to crash the program for unsupported parameter configurations!

pa-bin: Unified binary

Use cargo run --bin pa-bin -- <arguments> input/file/or/dir.{txt,seq,fa} to run any of the supported aligners on some input.

Succinct help of pa-bin (see --help for more):
CLI tool that wraps other aligners and runs them on the given input

Usage: pa-bin [OPTIONS] <--aligner <ALIGNER>|--params <PARAMS>|--params-file <PATH>|--print-params <ALIGNER>> [INPUT] [OUTPUT]

Arguments:
  [INPUT]   (Directory of) .seq, .txt, or Fasta files with sequence pairs to align
  [OUTPUT]  Write a .csv of `{cost},{cigar}` lines. Defaults to input file with .csv extension

Options:
      --cost-only  Return only cost (no traceback)
      --silent     Do not print anything to stderr
  -h, --help       Print help (see more with '--help')

Aligner:
      --aligner <ALIGNER>       The aligner to use with default parameters [possible values: astar-nw, astar-pa,
                                block-aligner, edlib, ksw2, triple-accel, wfa]
      --params <PARAMS>         Yaml/json string of aligner parameters
      --params-file <PATH>      File with aligner parameters
      --print-params <ALIGNER>  Print default parameters for the given aligner [possible values: astar-nw, astar-pa,
                                block-aligner, edlib, ksw2, triple-accel, wfa]
      --json                    The parameters are json instead of yaml

Cost model:
      --sub <COST>     Substitution cost, (> 0) [default: 1]
      --open <COST>    Gap open cost (>= 0) [default: 0]
      --extend <COST>  Gap extend cost (> 0) [default: 1]

The aligner to run can be specified with --aligner <ALIGNER> for default arguments, or --params[-file] to read a (yaml or json) string of parameters (from a file). Use --print-params <ALIGNER> to get default parameters that can be modified.

pa-bench: Benchmarking

For benchmarking, see input format, usage, and quick start below.

Benchmarking is done using jobs. Each job consists on an input dataset (a .seq file), a cost model, and a tool with parameters. The pa-bench binary calls itself (recursively) for each job to measure time and memory usage. An experiment consists of a yaml input configuration file is used to specify the list of jobs to run.

Results are incrementally accumulated in a json results file.

Quick start

The easiest way to get started is probably to first clone (and fork) the repository. Then, you can copy either:

  • The evals/astarpa directory with all experiments (*.yaml) and analysis/plots (evals.ipynb) used in the A*PA paper.
  • The evals/astarpa-next directory that specifically tests new versions of A*PA on some datasets of ultra long ONT reads of human data. This contains the code to plot boxplots+swarmplots of the distribution of runtimes on a dataset.
  • Or you can modify/add experiments to evals/experiments/ and use evals/evals.ipynb.

If you think your experiments, analysis, and/or plots are generally useful and interesting, feel free to make a PR to add them here.

Benchmarking features

Main settings

  • Time limit: Use --time-limit 1h to limit each run to 1 hour using ulimit.
  • Memory: Use --mem-limit GiB to limit each run to 1GiB of total memory using ulimit.
  • Nice: Use --nice=-20 to increase the priority of each runner job. This requires root. (See the end of this file.)
  • Parallel running: Use -j 10 to run 10 jobs in parallel. Each job is pinned to a different core.
  • Pinning: By default, each job is fixed to run on a single core. This doesn't work on all OSes and can crash/Panic the runner. Use --no-pin to avoid this.
  • Incremental running: By default, jobs results already present in the target json file are reused. With --rerun-failed, failed jobs are retried, and with --rerun-all, all jobs are rerun. --clean completely removes the cache.

Debugging failing jobs

  • To see which jobs are being run, use --verbose.
  • To see the error output of runners, use --stderr. This should be the first thing to do to figure out why jobs are failing.

Output

Output is written to a json file, and also written to a cache that can be reused across experiments.

  • Runtime of processing input pairs, excluding startup and file io time.
  • Maximum memory usage (max rss), excluding the memory usage of the input data.
  • Start and end time of job, for logging purposes.
  • CPU frequency at start and end of job, as a sanity check.

Other

  • Skipping: When a job fails, all larger jobs (larger n or e) are automatically skipped.
  • Interrupting: You can interrupt a run at any time with ctrl-C. This will stop ongoing jobs and write results so far to disk.
  • Cigar checking: When traceback is enabled, all Cigar strings are checked to see whether they are valid and have the right cost.
  • Cost checking: The cost returned by exact aligners is cross-validated. For inexact aligners, the fraction of correct results is computed.

Input format

The input is specified as a yaml file containing:

  • datasets: file paths or settings to generate datasets;
  • traces: whether each tool computes a path or only the edit distance;
  • costs: the cost models to run all aligners on;
  • algos: the algorithms (aligners with parameters) to use.

A job is created for the each combination of the 4 lists.

Examples can be found in evals/experiments/. Here is one:

datasets:
  # Hardcoded data
  - !Data
    - - CGCTGGCTGCTGCCACTAACTCCGTATAGTCTCACCAAGT
      - CGCTGGCTCGCCTGCCACGTAACTCCGTATAGTCTCACCAACTGTCAGTT
    - - AACCAGGGTACACCGACTAATCCACGCACAAGTTGGGGTC
      - ACAGGTACACCACTATCACGACAAGTTGGGTC
  # Path to a single .seq file, relative to `evals/data`
  - !Path path/to/sequences.seq
  # Recursively finds all non-hidden .seq files in a directory, relative to `evals/data`
  - !Path path/to/directory
  # Download and extract a zip file containing .seq files to `evals/data/download/{dir}`
  - !Download
    url: https://github.com/pairwise-alignment/pa-bench/releases/download/datasets/ont-500k.zip
    dir: ont-500k
  # Generated data in `evals/data/generated/`
  - !Generated # Seed for the RNG.
    seed: 31415
    # The approximate total length of the input sequences.
    total_size: 100000
    # The error models to use. See pa-generate crate for more info:
    # https://github.com/pairwise-alignment/pa-generate
    error_models:
      # Uniform, NoisyInsert, NoisyDelete, NoisyMove, NoisyDuplicate, SymmetricRepeat
      - Uniform
    error_rates: [0.01, 0.05, 0.1, 0.1]
    lengths: [100, 1000, 10000, 100000]
# Run both with and without traces
traces: [false, true]
costs:
  # unit costs
  - { sub: 1, open: 0, extend: 1 }
  # affine costs
  - { sub: 1, open: 1, extend: 1 }
algos:
  - !BlockAligner
    size: !Size [32, 8192]
  - !ParasailStriped
  - !Edlib
  - !TripleAccel
  - !Wfa
    memory_model: !MemoryUltraLow
    heuristic: !None
  - !Ksw2
    method: !GlobalSuzukiSse
    band_doubling: false
  - !AstarPa

Usage

  1. Clone this repo and make sure you have Rust installed.
  2. Run cargo run --release -- [--release] evals/experiments/test.yaml from the root.
  3. In case of errors, add --verbose to see which jobs are being run, and/or --stderr to see the output of failing (Result: Err(Panic)) jobs. For non-linus OSes, you may need to add --no-bin to disable pinning to specific cores.

First, this will generate/download required input data files in evals/data. Results are written to evals/results/test.json and a cache of all (outdated) jobs for the current experiment is stored in evals/results/test.cache.json or at the provided --cache.

Succinct help of pa-bench (see --help for more):
Usage: pa-bench bench [OPTIONS] [EXPERIMENTS]...

Arguments:
  [EXPERIMENTS]...  Path to an experiment yaml file

Options:
  -o, --output <OUTPUT>  Path to the output json file. By default mirrors the `experiments` dir in `results`
      --cache <CACHE>    Shared cache of JobResults. Default: <experiment>.cache.json
      --no-cache         Completely disable using a cache
  -j <NUM_JOBS>          Number of parallel jobs to use [default: 5]
      --rerun-all        Ignore job cache, i.e. rerun jobs already present in the results file
      --rerun-failed     Rerun failed jobs that are otherwise reused
      --release          Shorthand for '-j1 --nice=-20'
  -h, --help             Print help (see more with '--help')

Limits:
  -t, --time-limit <TIME_LIMIT>  Time limit. Defaults to value in experiment yaml or 1m
  -m, --mem-limit <MEM_LIMIT>    Memory limit. Defaults to value in experiment yaml or 1GiB
      --nice <NICE>              Process niceness. '--nice=-20' for highest priority
      --no-pin                   Disable pinning, which may not work on OSX

Output:
  -v, --verbose  Print jobs started and finished
      --stderr   Show stderr of runner process

Notes on benchmarking

Niceness. Changing niceness to -20 (the highest priority) requires running pa-bench as root. Alternatively, you could add the following line to /etc/security/limits.conf to allow your user to use lower niceness values:

<username> - nice -20

Pinning. Pinning jobs to cores probably only works on linux. On other systems, benchmarking will crash and will report Result: Err(Panic). Use --no-pin to avoid this.

CPU Settings. Make sure to

  • fix the cpu frequency using cpupower frequency-set -d 2.6GHz -u 2.6GHz -g powersave (powersave can give more consistent results than performance),
  • disable hyperthreading,
  • disable turbo-boost,
  • disable power saving,
  • the laptop is fully charged and connected to power.

Datasets

Datasets are available in the datasets release.

Code layout

Dependency graph

From low-level to higher, the following crates are relevant:

  • pa-types: Basic pairwise alignment types such as Seq, Pos, Cost and Cigar.
  • pa-generate: A utility to generate sequence pairs with various kinds or error types.
  • pa-wrapper contains an AlignerTrait and implements this uniform interface for all aligners. Each aligner is behind a feature flag. Parasailors is disabled by default do reduce the otherwise large build time.
  • pa-bin is a thin binary/CLI around pa-wrappers.
  • pa-bench-types contains the definition of a Experiment, Dataset, Job, JobResult, and the AlgorithmParams enum that selects the algorithm to run and its parameters. This causes pa-bench-types to have dependencies on crates that contain aligner-specific parameter types.
  • pa-bench contains a binary that collects all jobs in an experiment and calls itself once per job.