abriTAMR is an AMR gene/variant detection pipeline that runs AMRFinderPlus on bacteiral genome assemblues, categorises the variants into reportable/not-reportable, and sorts into clinical drug classes.
abriTAMR is accredited by NATA for use in identifying the presence of reportable AMR genes the MDU PHL in Victoria, Australia.
% conda create -n abritamr -c bioconda abritamr
% conda activate abritamr
% abritamr --version
% abritamr run -c genome.fasta
% ls abritamr
abritamr.log summary_partials.txt
amrfinder.out summary_virulence.txt
summary_matches.txt update_abritamr_db.log
% cat abritamr/abritamr.txt
Isolate Methicillin Tetracycline Tigecycline Beta-lactam Penicillin resistance (Staphylococcus aureus)
abritamr mecA,mecR1^ tet(38)* mepA* blaI*,blaR1* blaZ
The -c option is used for input, and
can accept 2 types of files:
- a single FASTA file, usually a genome assembly:
>contug001
AGTCTCGATATGCTATAGGCTTATATATAT
ATGCTATAGGCTTATATATATTTATATCTT
>contig002
CGATATGCTATAGGCTTATATATATTTATA
...
- a TSV file for multiple FASTA files:
ID1 <tab> /path/to/assembly1.fasta
ID2 <tab> /path/to/second/file.fna
...
abritamr run --help
optional arguments:
-h, --help show this help message and exit
--contigs CONTIGS, -c CONTIGS
Tab-delimited file with sample ID as column 1 and path to assemblies as column 2 OR path to a contig
file (used if only doing a single sample - should provide value for -pfx). (default: )
--prefix PREFIX, -px PREFIX
If running on a single sample, please provide a prefix for output directory (default: abritamr)
--jobs JOBS, -j JOBS Number of AMR finder jobs to run in parallel. (default: 16)
--identity IDENTITY, -i IDENTITY
Set the minimum identity of matches with amrfinder (0 - 1.0). Defaults to amrfinder preset, which is 0.9
unless a curated threshold is present for the gene. (default: )
--amrfinder_db AMRFINDER_DB, -d AMRFINDER_DB
Path to amrfinder DB to use (default:
/<path_to_installation>/abritamr/abritamr/db/amrfinderplus/data/2021-09-30.1)
--species {Neisseria,Clostridioides_difficile,Acinetobacter_baumannii,Campylobacter,Enterococcus_faecalis,Enterococcus_faecium,Escherichia,Klebsiella,Salmonella,Staphylococcus_aureus,Staphylococcus_pseudintermedius,Streptococcus_agalactiae,Streptococcus_pneumoniae,Streptococcus_pyogenes}, -sp {Neisseria,Clostridioides_difficile,Acinetobacter_baumannii,Campylobacter,Enterococcus_faecalis,Enterococcus_faecium,Escherichia,Klebsiella,Salmonella,Staphylococcus_aureus,Staphylococcus_pseudintermedius,Streptococcus_agalactiae,Streptococcus_pneumoniae,Streptococcus_pyogenes}
Set if you would like to use point mutations, please provide a valid species. (default: )
You can also run abriTAMR in report mode, this will output a spreadsheet which is based on reportable/not-reportable requirements in Victoria. You will need to supply a quality control file (comma separated) (-q), with the following columns:
- ISOLATE
- SPECIES_EXP (the species that was expected)
- SPECIES_OBS (the species that was observed during the quality control analysis)
- TEST_QC (PASS or FAIL)
--sop refers to the type of collation and reporting pipeline
- general
- standard reporting structure for aquired genes, output as reportable and non-reportable
- plus
- Inferred AST based on validation undertaken at MDU
abritamr report --help
optional arguments:
-h, --help show this help message and exit
--qc QC, -q QC Name of checked MDU QC file. (default: )
--runid RUNID, -r RUNID
MDU RunID (default: Run ID)
--matches MATCHES, -m MATCHES
Path to matches, concatentated output of abritamr (default: summary_matches.txt)
--partials PARTIALS, -p PARTIALS
Path to partial matches, concatentated output of abritamr (default: summary_partials.txt)
--sop {general,plus} The MDU pipeline for reporting results. (default: general)
Outputs 4 summary files and retains the raw AMRFinderPlus output for each sequence input.
-
amrfinder.outraw output from AMRFinder plus (per sequence). For more information please see AMRFinderPlus help here -
summary_matches.txt
-
Tab-delimited file, with a row per sequence, and columns representing functional drug classes
-
Only genes recovered from sequence which have >90% coverage of the gene reported and greater than the desired identity threshold (default 90%).
I. Genes annotated with
*indicate >90% coverage and > identity threshold < 100% identity.II. No further annotation indicates that the gene recovered exhibits 100% coverage and 100% identity to a gene in the gene catalog.
III. Point mutations detected (if
--speciessupplied) will also be present in this file in the form ofgene_AAchange.
summary_partials.txt
- Tab-delimited file, with a row per sequence, and columns representing functional drug classes
- Genes recovered from sequence which have >50% but <90% coverage of the gene reported and greater than the desired identity threshold (default 90%).
summary_virulence.txt
-
Tab-delimited file, with a row per sequence, and columns representing AMRFinderPlus virulence gene classification
-
Genes recovered from sequence which have >50% coverage of the gene reported and greater than the desired identity threshold (default 90%).
- Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with
^. - Genes annotated with
*indicate >90% coverage and > identity threshold < 100% identity.
- Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with
abritamr.txt
-
Tab-delimited file, combining
summary_matches.txt,summary_partials.txt,summary_virulence.txtwith a row per sequence, and columns representing AMRFinderPlus virulence gene classification and/or functional drug classes. -
Genes recovered from sequence which have >50% coverage of the gene reported and greater than the desired identity threshold (default 90%).
- Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with
^. - Genes annotated with
*indicate >90% coverage and > identity threshold < 100% identity.
- Genes recovered with >50% but <90% coverage of a gene in the gene catalog will be annotated with
will output spreadsheets general_runid.xlsx (NATA accredited) or plus_runid.xlsx (validated - not yet accredited) depending upon the sop chosen.
general_rundid.xlsxhas two tabs, one for matches and one for partials (corresponding to genes reported in thesummary_matches.txtandsummary_partials.txt). Each tab has 7 columns
| Column | Interpretation |
|---|---|
| MDU sample ID | Sample ID |
| Item code | suffix (MDU specific) |
| Resistance genes (alleles) detected | genes detected that are reportable (based on species and drug classification) |
| Resistance genes (alleles) det (non-rpt) | other genes detected that are not not reportable for the species detected. |
| Species_obs | Species observed (supplied in input file) |
| Species_exp | Species expected (supplied in input file) |
| db_version | Version of the AMRFinderPlus DB used |
-
plus_runid.xlsxoutput is a spreadsheet with the different drug resistance mechanims and the corresponding interpretation (based on validation of genotype and phenotype) for drug-classes relevant to reporting of anti-microbial resistance in Salmonella enterica (other species will be added as validation of genotype vs phenotype is performed). -
Ampicillin
-
Cefotaxime (ESBL)
-
Cefotaxime (AmpC)
-
Tetracycline
-
Gentamicin
-
Kanamycin
-
Streptomycin
-
Sulfathiazole
-
Trimethoprim
-
Trim-Sulpha
-
Chloramphenicol
-
Ciprofloxacin
-
Meropenem
-
Azithromycin
-
Aminoglycosides (RMT)
-
Colistin
File questions, bugs, or ideas on the Issues page
Sherry, N.L., Horan, K.A., ... , Seemann, T. An ISO-certified genomics workflow for identification and surveillance of antimicrobial resistance Nat Commun 14;60 (2023). DOI:10.1038/s41467-022-35713-4 PMID:36599823
- Kristy Horan
- Torsten Seemann
- Norelle Sherry
- CHarlie Higgs (logo design)