TADs are 3D structural units of higher-order chromosome organization in Drosophila

Contribute Members

• 李柏漢
• 林穎彥
• 黃宇秀
• 邱淦均

Demo

** For the full demo version, please check: docs/hic-preprocess-steps.md

Data Proccess

# sra-tool env
docker pull ncbi/sra-tools
docker run -itd -v /mnt/e/workspace/bio-fp/:/home/yy/bio-fp --name yy-sra ncbi/sra-tools
docker attach yy-sra 

prefetch SRR5579177
fasterq-dump SRR5579177 -p

# other process env
docker pull ubuntu
docker images
docker run -itd -v /mnt/e/workspace/bio-fp/:/home/yy/bio-fp/ --name yy-biofp ubuntu
docker attach yy-biofp

apt install fastqc
fastqc reads_1.fastq reads_2.fastq
apt install cutadapt
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -q 20,20 -m 36 \
    -o trimmed_reads_SRR5579177_1.fastq -p trimmed_readsSRR5579177_2.fastq \
    SRR5579177_1.fastq SRR5579177_2.fastq

wget https://hgdownload.cse.ucsc.edu/goldenPath/dm3/bigZips/dm3.fa.gz
gunzip dm3.fa.gz
bowtie-build ../dm3.fa dm3_index
bowtie dm3_index -1 ../SRR5579177_1.fastq -2 ../SRR5579177_2.fastq  -t -a -m 1 --best -S dm3_bowtie_align_output.sam

samtools view -bS dm3_bowtie_align_output.sam > output.bam
samtools sort output.bam -o sorted.bam
    
pairtools parse -c dm3.chrom.sizes -o output.pairsam dm3_bowtie_align_output.sam
pairtools sort -o sorted.pairsam output.pairsam
pairtools dedup -o dedup.pairsam sorted.pairsam
pairtools select '(pair_type == "UU")' -o output.pairs dedup.pairsam

Visulaize: R

cd code
Rscript contact_file_generate.R

Rscript contact_map_generate.R 

Visulaize: Python with .cool

python3 build-cooler.py

cooler zoomify output.cool

python3 mcool_map.py

Folder organization and its related information

idea by Noble WS (2009) A Quick Guide to Organizing Computational Biology Projects. PLoS Comput Biol 5(7): e1000424.

docs

• Presentation:, 1131_bioinformatics_FP_group1.pdf

• Related Document

  • docs/hic-preprocess-steps.md
  • data/data-src.md

data (do not upload fastq file)

• Source
  • data/data-src.md (experiment data source details)
• Format
  • sra
  • fastq
  • fa (fasta)
  • sam
  • bam
  • txt
  • ebwt
• Size
  • SRA: ~ 15.3 GB
  • FASTQ: ~ 68 GB
  • FASTA (dm3): ~ 164 MB\
  • EBWT Bowtie Index: ~ 1 KB ~ 161 MB
  • SAM: ~ 115 GB
  • Sizes (dm3): ~ 1 KB
  • PairSAM: ~ 60.8 ~ 133 GB
  • Pairs: ~ 60.8 GB
  • BINS: ~ 332 KB

code

• Which packages do you use?

  • original packages in the paper
    • bowtie
  • additional packages you found
    • sra-tools
    • wget
    • fastqc
    • cutadapt
    • reptyr
    • samtools
    • pairtools
    • R Lib: ggplot2
    • R Lib: reshape2
    • Cooler
    • Python Lib: cooler

• Analysis steps

  • Download SRA/Reference Genome Files
  • Convert SRA to FASTQ
  • FASTQ Quality Control
  • Build Bowtie Index
  • Trimming
  • Alignment
  • Build Pairs
  • Store SAM
  • Create Contact File
  • Build Contact Matrix
  • Visualize Contact Map

results

• Reproduce Part
  • Figure 1A Hi-C Contact Map
  • result/res_10000_contact_heatmap.png
• QC Reports:
  • results/fastqc-report/SRR5579177_1_fastqc.html
  • results/fastqc-report/SRR5579177_2_fastqc.html

	Information
Organism	Drosophila melanogaster
Instrument Model	Illumina HiSeq 2500
Mapping Genome	Drosophila melanogaster genome (assembly dm3)
Data Processing Software	bowtie (params: -t -a -m 1 --best)

• Any improvement or change in your package?

References

Packages you use

SRA-Tools Docker

• SRA-Tools GitHub
• SRA-Tools Docker Hub
• SRA-Tools Docker Wiki
• Prefetch and Fasterq-Dump
• HowTo: Fasterq-Dump

Reference Genome

• dm3 related

Illumina

• Illumina sequencing libraries

Bowtie

• bowtie1 comparison
• installation
• bowtie2 docs
• bowtie 1 docs

bwa

• github

Pairs

• pairix
• pypairix
• pairtools
• micro-c
• pairs file format

Cool

• cooler doc
• cooler github

HIC-PRO

• hic-pro docs
• github

GenPipes

• docs
• Related publications