feat: add pytrf sub-commands as individual Snakemake-Wrappers

bio/pytrf/environment.linux-64.pin.txt

@@ -0,0 +1,37 @@
+# This file may be used to create an environment using:
+# $ conda create --name <env> --file <this file>
+# platform: linux-64
+# created-by: conda 26.1.1
+@EXPLICIT
+https://conda.anaconda.org/conda-forge/noarch/ca-certificates-2026.2.25-hbd8a1cb_0.conda#4492fd26db29495f0ba23f146cd5638d
+https://conda.anaconda.org/conda-forge/linux-64/libgomp-15.2.0-he0feb66_18.conda#239c5e9546c38a1e884d69effcf4c882
+https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.2-h25fd6f3_2.conda#d87ff7921124eccd67248aa483c23fec
+https://conda.anaconda.org/conda-forge/noarch/python_abi-3.12-8_cp312.conda#c3efd25ac4d74b1584d2f7a57195ddf1
+https://conda.anaconda.org/conda-forge/noarch/tzdata-2025c-hc9c84f9_1.conda#ad659d0a2b3e47e38d829aa8cad2d610
+https://conda.anaconda.org/conda-forge/linux-64/_openmp_mutex-4.5-20_gnu.conda#a9f577daf3de00bca7c3c76c0ecbd1de
+https://conda.anaconda.org/conda-forge/linux-64/zstd-1.5.7-hb78ec9c_6.conda#4a13eeac0b5c8e5b8ab496e6c4ddd829
+https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45.1-default_hbd61a6d_102.conda#18335a698559cdbcd86150a48bf54ba6
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-15.2.0-he0feb66_18.conda#0aa00f03f9e39fb9876085dee11a85d4
+https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-hda65f42_9.conda#d2ffd7602c02f2b316fd921d39876885
+https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.5-hecca717_0.conda#49f570f3bc4c874a06ea69b7225753af
+https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h3435931_0.conda#a360c33a5abe61c07959e449fa1453eb
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-15.2.0-h69a702a_18.conda#d5e96b1ed75ca01906b3d2469b4ce493
+https://conda.anaconda.org/conda-forge/linux-64/liblzma-5.8.2-hb03c661_0.conda#c7c83eecbb72d88b940c249af56c8b17
+https://conda.anaconda.org/conda-forge/linux-64/libnsl-2.0.1-hb9d3cd8_1.conda#d864d34357c3b65a4b731f78c0801dc4
+https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-15.2.0-h934c35e_18.conda#1b08cd684f34175e4514474793d44bcb
+https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.41.3-h5347b49_0.conda#db409b7c1720428638e7c0d509d3e1b5
+https://conda.anaconda.org/conda-forge/linux-64/ncurses-6.5-h2d0b736_3.conda#47e340acb35de30501a76c7c799c41d7
+https://conda.anaconda.org/conda-forge/linux-64/openssl-3.6.1-h35e630c_1.conda#f61eb8cd60ff9057122a3d338b99c00f
+https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_h366c992_103.conda#cffd3bdd58090148f4cfcd831f4b26ab
+https://conda.anaconda.org/conda-forge/linux-64/icu-78.3-h33c6efd_0.conda#c80d8a3b84358cb967fa81e7075fbc8a
+https://conda.anaconda.org/conda-forge/linux-64/libxcrypt-4.4.36-hd590300_1.conda#5aa797f8787fe7a17d1b0821485b5adc
+https://conda.anaconda.org/conda-forge/linux-64/readline-8.3-h853b02a_0.conda#d7d95fc8287ea7bf33e0e7116d2b95ec
+https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.52.0-hf4e2dac_0.conda#fd893f6a3002a635b5e50ceb9dd2c0f4
+https://conda.anaconda.org/conda-forge/linux-64/python-3.12.13-hd63d673_0_cpython.conda#7eccb41177e15cc672e1babe9056018e
+https://conda.anaconda.org/conda-forge/noarch/packaging-26.0-pyhcf101f3_0.conda#b76541e68fea4d511b1ac46a28dcd2c6
+https://conda.anaconda.org/bioconda/linux-64/pyfastx-2.3.0-py312h71493bf_2.conda#fe85dfc20384f1055cadcf981b7da973
+https://conda.anaconda.org/conda-forge/noarch/setuptools-82.0.1-pyh332efcf_0.conda#8e194e7b992f99a5015edbd4ebd38efd
+https://conda.anaconda.org/bioconda/noarch/snakemake-wrapper-utils-0.8.0-pyhdfd78af_0.conda#1650e521333852f45468d97b1b2fdcce
+https://conda.anaconda.org/bioconda/linux-64/pytrf-1.4.2-py312h0fa9677_1.conda#a0c079e205c567635a2b5f22054ffc62
+https://conda.anaconda.org/conda-forge/noarch/wheel-0.46.3-pyhd8ed1ab_0.conda#bdbd7385b4a67025ac2dba4ef8cb6a8f
+https://conda.anaconda.org/conda-forge/noarch/pip-26.0.1-pyh8b19718_0.conda#67bdec43082fd8a9cffb9484420b39a2

bio/pytrf/environment.yaml

@@ -0,0 +1,7 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+dependencies:
+  - pytrf =1.4
+  - snakemake-wrapper-utils =0.8.0

bio/pytrf/meta.yaml

@@ -0,0 +1,38 @@
+name: pytrf
+description: >
+  Tandem Repeat (TR) finding and extraction toolkit.
+  Supports finding exact short TRs (findstr), generic TRs (findgtr),
+  approximate TRs (findatr), and extracting sequences (extract).
+url: https://pytrf.readthedocs.io/en/latest/usage.html
+authors:
+  - Muhammad Rohan Ali Asmat
+input:
+  - seq: FASTA or FASTQ file (supports gzip compression)
+  - repeat: For extract only - TSV/CSV file from findstr/findgtr/findatr
+output:
+  - Output file (required). Format auto-detected from file extension.
+params:
+  - subcommand: PyTRF subcommand to run [`findstr`, `findgtr`, `findatr`, `extract`].
+  - extra: Additional command-line arguments passed to pytrf.
+notes: >
+  **Subcommands:** |nl|
+  - findstr: Find exact short tandem repeats (STRs/microsatellites) |nl|
+  - findgtr: Find exact generic tandem repeats |nl|
+  - findatr: Find approximate/imperfect tandem repeats |nl|
+  - extract: **NOT WORKING** - Extract TR sequences and flanking sequence (bug in PyTRF 1.4.2, see known issues) |nl|
+  |nl|
+  **All commands require named input 'seq'** (fasta/fastq). |nl|
+  **Extract also requires 'repeat'** (tsv/csv from findstr/findgtr/findatr). |nl|
+  |nl|
+  **Bioconda package:** https://bioconda.github.io/recipes/pytrf/README.html |nl|
+  **GitHub repository:** https://github.com/lmdu/pytrf |nl|
+  **License:** MIT License |nl|
+  **Disclaimer:** This is a minimal implementation supporting basic functionality.
+  pytrf is not a Python binding to TRF - it's an independent tool. |nl|
+  |nl|
+  **Testing:** |nl|
+  This wrapper skips extract test until upstream patch is released. |nl|
+  |nl|
+  **Known issues:** |nl|
+  - PyTRF 1.4.2 has a bug in findstr bed output format (https://github.com/lmdu/pytrf/issues/7) |nl|
+  - PyTRF 1.4.2 has a bug in extract command (https://github.com/lmdu/pytrf/issues/6)

bio/pytrf/test/Snakefile

@@ -0,0 +1,78 @@
+########################################################
+# Snakefile for pytrf wrapper
+########################################################
+
+
+# SAMPLE RULE: Find exact short tandem repeats (STRs/SSRs)
+rule pytrf_findstr:
+    input:
+        seq="demo_data/{sample}.fasta",
+    output:
+        "results/{sample}_findstr.csv",
+    log:
+        "logs/{sample}.log",
+    params:
+        subcommand="findstr",
+        extra="-r 5 1 3 3 3 3",
+    wrapper:
+        "master/bio/pytrf"
+
+
+# SAMPLE RULE: Find exact STRs with default parameters
+rule pytrf_findstr_defaults:
+    input:
+        seq="demo_data/small_test.fasta",
+    output:
+        "results/small_test_findstr_defaults.tsv",
+    log:
+        "logs/small_test_defaults.log",
+    params:
+        subcommand="findstr",
+    wrapper:
+        "master/bio/pytrf"
+
+
+# SAMPLE RULE: Find generic tandem repeats
+rule pytrf_findgtr:
+    input:
+        seq="demo_data/{sample}.fasta",
+    output:
+        "results/{sample}_findgtr.tsv",
+    log:
+        "logs/{sample}.log",
+    params:
+        subcommand="findgtr",
+        extra="-m 3 -r 1",  # min-motif=3, min-repeat=1
+    wrapper:
+        "master/bio/pytrf"
+
+
+# SAMPLE RULE: Find approximate tandem repeats
+rule pytrf_findatr:
+    input:
+        seq="demo_data/{sample}.fasta",
+    output:
+        "results/{sample}_findatr.tsv",
+    log:
+        "logs/{sample}.log",
+    params:
+        subcommand="findatr",
+        extra="-m 3 -M 10",  # min-motif-size=3, max-motif-size=10
+    wrapper:
+        "master/bio/pytrf"
+
+
+# SAMPLE RULE: Extract TR sequences (NOT WORKING - see meta.yaml notes)
+rule pytrf_extract:
+    input:
+        seq="demo_data/small_test_extract.fasta",  # sequence fasta
+        repeat="demo_data/small_test_extract.tsv",  # repeat file from findstr/findgtr/findatr
+    output:
+        "results/small_test_extract.tsv",
+    log:
+        "logs/small_test_extract.log",
+    params:
+        subcommand="extract",
+        extra="-l 150",  # flank-length=150
+    wrapper:
+        "master/bio/pytrf"

bio/pytrf/test/demo_data/small_test.fasta

@@ -0,0 +1,2 @@
+>seq1
+TCATCGGTCATCGGTCATCGGTCATCGGTCATCGG

bio/pytrf/test/demo_data/small_test_extract.fasta

@@ -0,0 +1,6 @@
+>seq1
+TCATCGGTCATCGGTCATCGGTCATCGGTCATCGG
+>seq2
+ACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGT
+>seq3
+TGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACA

bio/pytrf/test/demo_data/small_test_extract.tsv

@@ -0,0 +1,85 @@
+seq1	1	3	TCA	3	1	3
+seq1	4	6	TCG	3	1	3
+seq1	7	9	GTC	3	1	3
+seq1	10	12	ATC	3	1	3
+seq1	13	15	GGT	3	1	3
+seq1	16	18	CAT	3	1	3
+seq1	19	21	CGG	3	1	3
+seq1	22	24	TCA	3	1	3
+seq1	25	27	TCG	3	1	3
+seq1	28	30	GTC	3	1	3
+seq1	31	33	ATC	3	1	3
+seq1	34	36	GG	3	1	3
+seq2	1	3	ACC	3	1	3
+seq2	4	6	CCT	3	1	3
+seq2	7	9	CAG	3	1	3
+seq2	10	12	GGT	3	1	3
+seq2	13	15	ACC	3	1	3
+seq2	16	18	CCT	3	1	3
+seq2	19	21	CAG	3	1	3
+seq2	22	24	GGT	3	1	3
+seq2	25	27	ACC	3	1	3
+seq2	28	30	CCT	3	1	3
+seq2	31	33	CAG	3	1	3
+seq2	34	36	GGT	3	1	3
+seq2	37	39	ACC	3	1	3
+seq2	40	42	CCT	3	1	3
+seq2	43	45	CAG	3	1	3
+seq2	46	48	GGT	3	1	3
+seq2	49	51	ACC	3	1	3
+seq2	52	54	CCT	3	1	3
+seq2	55	57	CAG	3	1	3
+seq2	58	60	GGT	3	1	3
+seq2	61	63	ACC	3	1	3
+seq2	64	66	CCT	3	1	3
+seq2	67	69	CAG	3	1	3
+seq2	70	72	GGT	3	1	3
+seq2	73	75	ACC	3	1	3
+seq2	76	78	CCT	3	1	3
+seq2	79	81	CAG	3	1	3
+seq2	82	84	GGT	3	1	3
+seq3	1	3	TGA	3	1	3
+seq3	4	6	CTA	3	1	3
+seq3	7	9	TAT	3	1	3
+seq3	10	12	CCG	3	1	3
+seq3	13	15	CAA	3	1	3
+seq3	16	18	ATG	3	1	3
+seq3	19	21	AAG	3	1	3
+seq3	22	24	GCT	3	1	3
+seq3	25	27	GTT	3	1	3
+seq3	28	31	CT	2	2	4
+seq3	32	34	GAC	3	1	3
+seq3	35	37	ATG	3	1	3
+seq3	38	40	ACT	3	1	3
+seq3	41	44	AT	2	2	4
+seq3	45	47	CCG	3	1	3
+seq3	48	50	CAA	3	1	3
+seq3	51	53	ATG	3	1	3
+seq3	54	56	AAG	3	1	3
+seq3	57	59	GCT	3	1	3
+seq3	60	62	GTT	3	1	3
+seq3	63	66	CT	2	2	4
+seq3	67	69	GAC	3	1	3
+seq3	70	72	ATG	3	1	3
+seq3	73	75	ACT	3	1	3
+seq3	76	79	AT	2	2	4
+seq3	80	82	CCG	3	1	3
+seq3	83	85	CAA	3	1	3
+seq3	86	88	ATG	3	1	3
+seq3	89	91	AAG	3	1	3
+seq3	92	94	GCT	3	1	3
+seq3	95	97	GTT	3	1	3
+seq3	98	101	CT	2	2	4
+seq3	102	104	GAC	3	1	3
+seq3	105	107	ATG	3	1	3
+seq3	108	110	ACT	3	1	3
+seq3	111	114	AT	2	2	4
+seq3	115	117	CCG	3	1	3
+seq3	118	120	CAA	3	1	3
+seq3	121	123	ATG	3	1	3
+seq3	124	126	AAG	3	1	3
+seq3	127	129	GCT	3	1	3
+seq3	130	132	GTT	3	1	3
+seq3	133	136	CT	2	2	4
+seq3	137	139	GAC	3	1	3
+seq3	140	142	A	3	1	3

bio/pytrf/test/expected/findatr_basic.tsv

@@ -0,0 +1 @@
+seq1	1	35	TCATCGG	7	5.0	35	1	35	5	35	35	0	0	0	100.0

bio/pytrf/test/expected/findgtr_basic.tsv

@@ -0,0 +1 @@
+seq1	1	35	TCATCGG	7	5	35

bio/pytrf/test/expected/findstr_basic.csv

@@ -0,0 +1,18 @@
+seq1,1,2,TC,2,1,2
+seq1,3,4,AT,2,1,2
+seq1,5,6,CG,2,1,2
+seq1,7,8,GT,2,1,2
+seq1,9,10,CA,2,1,2
+seq1,11,12,TC,2,1,2
+seq1,13,14,GG,2,1,2
+seq1,15,16,TC,2,1,2
+seq1,17,18,AT,2,1,2
+seq1,19,20,CG,2,1,2
+seq1,21,22,GT,2,1,2
+seq1,23,24,CA,2,1,2
+seq1,25,26,TC,2,1,2
+seq1,27,28,GG,2,1,2
+seq1,29,30,TC,2,1,2
+seq1,31,32,AT,2,1,2
+seq1,33,34,CG,2,1,2
+seq1,35,36,G,2,1,2

bio/pytrf/wrapper.py

@@ -0,0 +1,70 @@
+"""
+Snakemake Wrapper for PyTRF
+------------------------------------------------------
+Tandem repeat finding and extraction toolkit.
+Supports: findstr, findgtr, findatr, extract subcommands.
+"""
+
+from pathlib import Path
+from snakemake.shell import shell
+from snakemake_wrapper_utils.snakemake import get_format, is_arg
+
+# Configuration variables
+VALID_SUBCOMMANDS = {"findstr", "findgtr", "findatr", "extract"}
+FORMAT_SUPPORT = {
+    "findstr": {"tsv", "csv", "bed", "gff"},
+    "findgtr": {"tsv", "csv", "gff"},
+    "findatr": {"tsv", "csv", "gff"},
+    "extract": {"tsv", "csv", "fasta"},
+}
+
+log = snakemake.log_fmt_shell(stdout=True, stderr=True)
+extra = snakemake.params.get("extra", "")
+
+# Get subcommand type and validate
+if snakemake.params.subcommand not in VALID_SUBCOMMANDS:
+    raise ValueError(
+        f"Invalid subcommand '{snakemake.params.subcommand}'. "
+        f"Valid options: {', '.join(sorted(VALID_SUBCOMMANDS))}"
+    )
+
+# Get repeat file (extract only)
+repeat_file = ""
+if snakemake.params.subcommand == "extract":
+    repeat_file = f"-r {snakemake.input.repeat}"
+    if is_arg("-r", extra) or is_arg("--repeat-file", extra):
+        raise ValueError(
+            "Repeat file is provided as input.repeat. "
+            "Do not specify -r/--repeat-file in params.extra"
+        )
+
+# Infer and validate output format
+out_format = get_format(snakemake.output[0])
+if out_format not in FORMAT_SUPPORT[snakemake.params.subcommand]:
+    raise ValueError(
+        f"Unsupported format '{out_format}' for pytrf {snakemake.params.subcommand}. "
+        f"Supported formats: {', '.join(sorted(supported_formats))}"
+    )
+
+# Validate: block format and output flags
+if (
+    is_arg("-f", extra)
+    or is_arg("--out-format", extra)
+    or is_arg("-o", extra)
+    or is_arg("--out-file", extra)
+):
+    raise ValueError(
+        "Output format is inferred and output path is provided through Snakemake. "
+        "Do not specify -f/--out-format or -o/--out-file in params.extra"
+    )
+
+# Execute
+shell(
+    "pytrf {snakemake.params.subcommand}"
+    " {snakemake.input.seq}"
+    " {repeat_file}"
+    " {extra}"
+    " -f {out_format}"
+    " -o {snakemake.output[0]}"
+    " {log}"
+)